array:25 [
  "pii" => "S2255534X18301099"
  "issn" => "2255534X"
  "doi" => "10.1016/j.rgmxen.2018.03.012"
  "estado" => "S300"
  "fechaPublicacion" => "2019-04-01"
  "aid" => "476"
  "copyright" => "Asociación Mexicana de Gastroenterología"
  "copyrightAnyo" => "2018"
  "documento" => "article"
  "crossmark" => 1
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Rev Gastroenterol Mex. 2019;84:158-64"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:2 [
    "total" => 1386
    "formatos" => array:3 [
      "EPUB" => 160
      "HTML" => 833
      "PDF" => 393
    ]
  ]
  "Traduccion" => array:1 [
    "es" => array:20 [
      "pii" => "S0375090618300934"
      "issn" => "03750906"
      "doi" => "10.1016/j.rgmx.2018.03.004"
      "estado" => "S300"
      "fechaPublicacion" => "2019-04-01"
      "aid" => "476"
      "copyright" => "Asociación Mexicana de Gastroenterología"
      "documento" => "article"
      "crossmark" => 1
      "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
      "subdocumento" => "fla"
      "cita" => "Rev Gastroenterol Mex. 2019;84:158-64"
      "abierto" => array:3 [
        "ES" => true
        "ES2" => true
        "LATM" => true
      ]
      "gratuito" => true
      "lecturas" => array:2 [
        "total" => 2829
        "formatos" => array:3 [
          "EPUB" => 203
          "HTML" => 1929
          "PDF" => 697
        ]
      ]
      "es" => array:12 [
        "idiomaDefecto" => true
        "cabecera" => "<span class="elsevierStyleTextfn">Art&#237;culo original</span>"
        "titulo" => "Asociaci&#243;n de los genotipos cagA&#44; vacA e IceA de <span class="elsevierStyleItalic">H&#46; pylori</span> con la gastritis cr&#243;nica y folicular en una poblaci&#243;n colombiana con alto riesgo de c&#225;ncer g&#225;strico"
        "tienePdf" => "es"
        "tieneTextoCompleto" => "es"
        "tieneResumen" => array:2 [
          0 => "es"
          1 => "en"
        ]
        "paginas" => array:1 [
          0 => array:2 [
            "paginaInicial" => "158"
            "paginaFinal" => "164"
          ]
        ]
        "titulosAlternativos" => array:1 [
          "en" => array:1 [
            "titulo" => "Association of the <span class="elsevierStyleItalic">Helicobacter pylori</span> cagA&#44; vacA&#44; and iceA genotypes with chronic follicular gastritis in a Colombian population at high risk for gastric cancer"
          ]
        ]
        "contieneResumen" => array:2 [
          "es" => true
          "en" => true
        ]
        "contieneTextoCompleto" => array:1 [
          "es" => true
        ]
        "contienePdf" => array:1 [
          "es" => true
        ]
        "autores" => array:1 [
          0 => array:2 [
            "autoresLista" => "Y&#46;H&#46; Carlosama-Rosero, H&#46; Bola&#241;os-Bravo, C&#46;H&#46; Sierra-T&#243;rres, E&#46;A&#46; Rosero"
            "autores" => array:4 [
              0 => array:2 [
                "nombre" => "Y&#46;H&#46;"
                "apellidos" => "Carlosama-Rosero"
              ]
              1 => array:2 [
                "nombre" => "H&#46;"
                "apellidos" => "Bola&#241;os-Bravo"
              ]
              2 => array:2 [
                "nombre" => "C&#46;H&#46;"
                "apellidos" => "Sierra-T&#243;rres"
              ]
              3 => array:2 [
                "nombre" => "E&#46;A&#46;"
                "apellidos" => "Rosero"
              ]
            ]
          ]
        ]
      ]
      "idiomaDefecto" => "es"
      "Traduccion" => array:1 [
        "en" => array:9 [
          "pii" => "S2255534X18301099"
          "doi" => "10.1016/j.rgmxen.2018.03.012"
          "estado" => "S300"
          "subdocumento" => ""
          "abierto" => array:3 [
            "ES" => true
            "ES2" => true
            "LATM" => true
          ]
          "gratuito" => true
          "lecturas" => array:1 [
            "total" => 0
          ]
          "idiomaDefecto" => "en"
          "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2255534X18301099?idApp=UINPBA000046"
        ]
      ]
      "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0375090618300934?idApp=UINPBA000046"
      "url" => "/03750906/0000008400000002/v1_201906020708/S0375090618300934/v1_201906020708/es/main.assets"
    ]
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S2255534X18301208"
    "issn" => "2255534X"
    "doi" => "10.1016/j.rgmxen.2018.09.005"
    "estado" => "S300"
    "fechaPublicacion" => "2019-04-01"
    "aid" => "489"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Rev Gastroenterol Mex. 2019;84:165-73"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 858
      "formatos" => array:3 [
        "EPUB" => 151
        "HTML" => 399
        "PDF" => 308
      ]
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Functional and histologic effects after implanting pluripotent stem cells in a murine model with sphincterotomy"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "165"
          "paginaFinal" => "173"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Efectos funcionales e histol&#243;gicos posteriores al implante de c&#233;lulas madre pluripotentes en un modelo murino con esfinterotom&#237;a"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0015"
          "etiqueta" => "Figure 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 1019
              "Ancho" => 2831
              "Tamanyo" => 624399
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Histopathologic analysis&#46; Histopathologic sections stained with Masson&#39;s trichrome&#46; Comparison of the microstructure between healthy tissue and the injured tissue from the groups that underwent the different treatments&#46; Groups 1&#44; 2&#44; and 3 showed severe&#44; moderate&#44; and mild microarchitectural alterations and inflammatory response&#44; respectively&#46; 1&#58; skeletal muscle fibers&#59; 2&#58; smooth muscle&#59; 3&#58; collagen fibers&#59; 4&#58; granulomas&#59; 5&#58; capillaries&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "G&#46;J&#46; V&#225;zquez-Zapi&#233;n, M&#46;E&#46; Ordo&#241;ez-Guti&#233;rrez, J&#46;I&#46; Minero-Alfaro, V&#46;H&#46; Guerrero-Guerrero, I&#46; Mora-Mendoza, M&#46;M&#46; Mata-Miranda"
          "autores" => array:6 [
            0 => array:2 [
              "nombre" => "G&#46;J&#46;"
              "apellidos" => "V&#225;zquez-Zapi&#233;n"
            ]
            1 => array:2 [
              "nombre" => "M&#46;E&#46;"
              "apellidos" => "Ordo&#241;ez-Guti&#233;rrez"
            ]
            2 => array:2 [
              "nombre" => "J&#46;I&#46;"
              "apellidos" => "Minero-Alfaro"
            ]
            3 => array:2 [
              "nombre" => "V&#46;H&#46;"
              "apellidos" => "Guerrero-Guerrero"
            ]
            4 => array:2 [
              "nombre" => "I&#46;"
              "apellidos" => "Mora-Mendoza"
            ]
            5 => array:2 [
              "nombre" => "M&#46;M&#46;"
              "apellidos" => "Mata-Miranda"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S0375090618301290"
        "doi" => "10.1016/j.rgmx.2018.03.009"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0375090618301290?idApp=UINPBA000046"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2255534X18301208?idApp=UINPBA000046"
    "url" => "/2255534X/0000008400000002/v1_201906191703/S2255534X18301208/v1_201906191703/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S2255534X18300902"
    "issn" => "2255534X"
    "doi" => "10.1016/j.rgmxen.2018.06.009"
    "estado" => "S300"
    "fechaPublicacion" => "2019-04-01"
    "aid" => "482"
    "documento" => "article"
    "crossmark" => 1
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Rev Gastroenterol Mex. 2019;84:149-57"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 1300
      "formatos" => array:3 [
        "EPUB" => 163
        "HTML" => 742
        "PDF" => 395
      ]
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Evaluation of gastric motility through surface electrogastrography in critically ill septic patients&#46; Comparison of metoclopramide and domperidone effects&#58; A pilot randomized clinical trial"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "149"
          "paginaFinal" => "157"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Evaluaci&#243;n de motilidad g&#225;strica mediante electrogastrograf&#237;a de superficie en pacientes cr&#237;ticos s&#233;pticos&#46; Comparaci&#243;n de los efectos de metoclopramida y domperidona&#58; un ensayo cl&#237;nicopiloto aleatorizado"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Figure 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 903
              "Ancho" => 3167
              "Tamanyo" => 356297
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Surface electrogastrography registers&#46; Frequency of gastric slow wave ranges&#58; A&#41; normal between 2&#46;4 to 3&#46;7 cpm&#46; B&#41; Bradygastria between 0&#46;5 to 2&#46;3 cpm&#46; C&#41; Tachygastria between 3&#46;8 to 10 cpm&#46; Each line represents one minute of the analysis&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "C&#46; Mancilla Asencio, L&#46;R&#46; G&#225;lvez-Ar&#233;valo, E&#46; Tobar Almonacid, G&#46; Landskron-Ramos, A&#46;M&#46; Madrid-Silva"
          "autores" => array:5 [
            0 => array:2 [
              "nombre" => "C&#46;"
              "apellidos" => "Mancilla Asencio"
            ]
            1 => array:2 [
              "nombre" => "L&#46;R&#46;"
              "apellidos" => "G&#225;lvez-Ar&#233;valo"
            ]
            2 => array:2 [
              "nombre" => "E&#46;"
              "apellidos" => "Tobar Almonacid"
            ]
            3 => array:2 [
              "nombre" => "G&#46;"
              "apellidos" => "Landskron-Ramos"
            ]
            4 => array:2 [
              "nombre" => "A&#46;M&#46;"
              "apellidos" => "Madrid-Silva"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "Traduccion" => array:1 [
      "es" => array:9 [
        "pii" => "S0375090618301009"
        "doi" => "10.1016/j.rgmx.2018.03.007"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "es"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0375090618301009?idApp=UINPBA000046"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2255534X18300902?idApp=UINPBA000046"
    "url" => "/2255534X/0000008400000002/v1_201906191703/S2255534X18300902/v1_201906191703/en/main.assets"
  ]
  "en" => array:20 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Association of the <span class="elsevierStyleItalic">Helicobacter pylori</span> cagA&#44; vacA&#44; and iceA genotypes with chronic follicular gastritis in a Colombian population at high risk for gastric cancer"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "158"
        "paginaFinal" => "164"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Y&#46;H&#46; Carlosama-Rosero, H&#46; Bola&#241;os-Bravo, C&#46;H&#46; Sierra-T&#243;rres, E&#46;A&#46; Rosero"
        "autores" => array:4 [
          0 => array:4 [
            "nombre" => "Y&#46;H&#46;"
            "apellidos" => "Carlosama-Rosero"
            "email" => array:1 [
              0 => "yeharca@hotmail.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "H&#46;"
            "apellidos" => "Bola&#241;os-Bravo"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "C&#46;H&#46;"
            "apellidos" => "Sierra-T&#243;rres"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "E&#46;A&#46;"
            "apellidos" => "Rosero"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">d</span>"
                "identificador" => "aff0020"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:4 [
          0 => array:3 [
            "entidad" => "Especialista en Anatom&#237;a Patol&#243;gica&#44; Magister en Epidemiolog&#237;a&#44; Grupo Interdisciplinario de Investigaci&#243;n en Salud-Enfermedad&#44; Profesor Universidad Cooperativa de Colombia&#44; Pasto&#44; Colombia"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Especialista en Anatom&#237;a Patol&#243;gica&#44; Magister en Oncolog&#237;a Molecular&#44; Grupo de Investigaci&#243;n en Gen&#233;tica Humana y Aplicada&#44; Universidad del Cauca&#44; Popay&#225;n&#44; Colombia"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Bi&#243;logo&#44; PhD en Epidemiolog&#237;a Molecular&#44; Grupo de Investigaci&#243;n en Gen&#233;tica Humana y Aplicada&#44; Universidad del Cauca&#44; Popay&#225;n&#44; Colombia"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
          3 => array:3 [
            "entidad" => "Especialista Salud Ocupacional&#46; Universidad Cooperativa de Colombia&#44; Pasto&#44; Colombia"
            "etiqueta" => "d"
            "identificador" => "aff0020"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "Corresponding author&#46; Tel&#46;&#58; &#43;3217230843&#59; Universidad Cooperativa de Colombia sede Pasto&#46; Calle 18&#35;47-150 Torobajo&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Asociaci&#243;n de los genotipos cagA&#44; vacA e IceA de <span class="elsevierStyleItalic">H&#46; pylori</span> con la gastritis cr&#243;nica y folicular en una poblaci&#243;n colombiana con alto riesgo de c&#225;ncer g&#225;strico"
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction and aims</span><p id="par0005" class="elsevierStylePara elsevierViewall">Follicular gastritis is characterized by a marked mononuclear inflammatory infiltrate and the formation of lymphoid follicles with a germinal center in the lamina propria&#46;<a class="elsevierStyleCrossRefs" href="#bib0205"><span class="elsevierStyleSup">1&#44;2</span></a> For some authors&#44; at least 2 secondary lymphoid follicles should be identified in an area 1<span class="elsevierStyleHsp" style=""></span>cm from the gastric mucosa to make the diagnosis&#46;<a class="elsevierStyleCrossRef" href="#bib0215"><span class="elsevierStyleSup">3</span></a> Disease prevalence is variable&#46; In Japan a prevalence of 0&#46;19&#37; was reported&#44; Greek and French researchers described a prevalence of 12&#46;7&#37; and 14&#46;2&#37;&#44; respectively&#44;<a class="elsevierStyleCrossRefs" href="#bib0220"><span class="elsevierStyleSup">4&#44;5</span></a> and in other studies&#44; prevalence varied from 27&#46;4&#37; to 79&#46;9&#37;&#46;<a class="elsevierStyleCrossRefs" href="#bib0230"><span class="elsevierStyleSup">6&#8211;8</span></a> A Colombian study described prevalence at 8&#46;4&#37;&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">9</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">The disease is associated with age&#44; <span class="elsevierStyleItalic">Helicobacter pylori</span> &#40;<span class="elsevierStyleItalic">H&#46; pylori</span>&#41; infection&#44; and the development of mucosa-associated lymphoid tissue &#40;MALT&#41; lymphoma&#46;<a class="elsevierStyleCrossRefs" href="#bib0205"><span class="elsevierStyleSup">1&#44;10</span></a> In relation to age&#44; a greater frequency of the disease has been determined in pediatric patients with persistent dyspeptic symptoms&#44; and in adolescents and young adults&#46; Female sex appears to be a special condition for the development of the pathology&#46;<a class="elsevierStyleCrossRefs" href="#bib0225"><span class="elsevierStyleSup">5&#44;11</span></a> Of greater importance is the relation of follicular gastritis to MALT lymphoma&#46; Even though lymphoma etiology can be linked to multiple factors&#44; <span class="elsevierStyleItalic">Helicobacter</span> infection appears to play a dominant role&#46; That role has been demonstrated&#44; following the regression of follicular gastritis and even MALT lymphoma after bacterial eradication&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">12</span></a> Nevertheless&#44; little is known about the cascade of events that occurs from follicular gastritis to the appearance of lymphoma&#46;<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">13</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">The relation of bacterial genotypes to certain kinds of diseases is well-known&#46; The cagA&#43;<span class="elsevierStyleHsp" style=""></span>and vacAs1&#47;m1 genotypes are considered the most virulent strains associated with peptic ulcer&#44; gastric cancer&#44; and severe inflammation&#44;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">14</span></a> whereas the s2&#47;m2 strain produces limited inflammation&#46; However&#44; little is known about the role of the bacterial genotypes in the origin of follicular gastritis&#46; In that context&#44; the aim of the present study was to establish the relation between the genetic variability of <span class="elsevierStyleItalic">H&#46; pylori</span> &#40;genotypes cagA&#44; vacA&#44; and iceA1&#41; and follicular gastritis&#46; The intention was to broaden the understanding of the determining factors of that condition and establish whether there is a bacterial genotype associated with it&#46; Because follicular gastritis is an entity related to gastric lymphoma&#44; the hypothesis is that the most aggressive bacterial genotypes are associated with that type of inflammation&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Materials and methods</span><p id="par0020" class="elsevierStylePara elsevierViewall">An analytic unmatched case-control study was conducted on patients that were admitted to the gastroenterology units of the <span class="elsevierStyleItalic">Hospital Universitario San Jos&#233;</span> and <span class="elsevierStyleItalic">Endovideo</span> in the city of Popay&#225;n &#40;located in Southwest Colombia in the Andes and catalogued as a high-risk area for gastric cancer&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">15</span></a> within the time frame of January 2008 and December 2011&#46; The study sample was obtained through convenience sampling and included patients above 18 years of age&#44; with a histopathologic diagnosis of follicular gastritis or nonatrophic gastritis &#40;the control group&#41;&#46; The participants&#44; as well as their parents&#44; had to be born in a municipality of the Cauca department&#46; Patients with atrophy&#44; metaplasia&#44; gastric cancer or other type of cancer&#44; gastric surgery&#44; previous treatment for <span class="elsevierStyleItalic">H&#46; pylori</span>&#44; or HIV infection were excluded&#46;</p><p id="par0025" class="elsevierStylePara elsevierViewall">Biologists from the <span class="elsevierStyleItalic">Grupo de Investigaci&#243;n en Gen&#233;tica Humana y Aplicada</span> &#40;<span class="elsevierStyleItalic">GIGHA</span>&#41; at the <span class="elsevierStyleItalic">Universidad del Cauca</span> applied a questionnaire to collect the sociodemographic variables &#40;age&#44; sex&#44; educational level&#44; income&#44; and ethnic group&#41;&#46; Gastric samples were obtained through gastrointestinal endoscopy performed by experienced gastroenterologists&#46; Patients were referred for endoscopy due to dyspeptic symptoms and they arrived for the examination having fasted for at least 8<span class="elsevierStyleHsp" style=""></span>hours&#46; The participants were not sedated but received a topical solution to anesthetize the pharynx&#46; Five samples were taken&#58; 2 biopsies from the antrum &#40;the greater and lesser curvatures&#41;&#44; 2 from the corpus &#40;the greater and lesser curvatures&#41; and one from the incisura angularis&#46; The biopsies were fixed in buffered formalin and stained with the hematoxylin-eosin and Giemsa stains&#46; The histopathologic analysis of each sample was carried out by 2 pathologists&#46; Visual analogue scales were employed according to the Sydney system&#46; The presence of both histologic activity &#40;inflammation due to polymorphonuclear neutrophils&#41; and <span class="elsevierStyleItalic">H&#46; pylori</span> was evaluated&#46; Follicular gastritis was defined as the presence of one or more lymphoid follicles with germinal centers in the lamina propria&#44; and its severity was staged on a scale from 1 to 5&#44; according to the Wotherspoon system<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">16</span></a> &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia><p id="par0030" class="elsevierStylePara elsevierViewall">To carry out the bacterial genotyping studies&#44; DNA was extracted from the biopsies embedded in paraffin&#44; utilizing the Chelex technique &#40;No&#46; C7901&#59; Sigma&#44; St&#46; Louis&#44; MO&#41;&#46; The cagA&#44; iceA1&#44; and vacA genes were amplified using the polymerase chain reaction &#40;PCR&#41; method previously described by Yamaoka et al&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">12</span></a> The PCR mixtures were prepared with 50 ng of genomic DNA&#44; 100<span class="elsevierStyleHsp" style=""></span>&#956;mol dNTPs&#44; 2&#46;5<span class="elsevierStyleHsp" style=""></span>&#956;l of 10X PCR buffer&#44; 1&#46;0<span class="elsevierStyleHsp" style=""></span>mM MgCl2&#44; 1 U of Taq DNA polymerase &#40;No&#46; M1665&#59; Promega&#44; Madison&#44; WI&#41;&#44; and 30<span class="elsevierStyleHsp" style=""></span>pmol of each of the primers&#44; as indicated in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; The reactions began with a denaturalization step at 95<span class="elsevierStyleHsp" style=""></span>&#176;C for 1<span class="elsevierStyleHsp" style=""></span>minute&#44; followed by 35 denaturalization cycles at 94<span class="elsevierStyleHsp" style=""></span>&#176;C for 1<span class="elsevierStyleHsp" style=""></span>minute&#44; hybridization at 52<span class="elsevierStyleHsp" style=""></span>&#176;C for 1<span class="elsevierStyleHsp" style=""></span>minute and extension at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 1<span class="elsevierStyleHsp" style=""></span>minute&#44; and a final extension step at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 10<span class="elsevierStyleHsp" style=""></span>minutes&#46; The products were analyzed through electrophoresis in 2&#37; agarose gels at 80 volts for 40<span class="elsevierStyleHsp" style=""></span>minutes and the genotypes were recognized according to the expected size of the base pairs&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia><p id="par0035" class="elsevierStylePara elsevierViewall">The NCTC-11637 and NCTC-11638 <span class="elsevierStyleItalic">H&#46; pylori</span> strains and the clinical 3062 isolate were provided by the <span class="elsevierStyleItalic">Instituto Nacional de Cancerolog&#237;a de Colombia</span> to be used as positive controls&#46; In addition&#44; all the PCR tests had internal amplification controls and adequate molecular markers &#40;ladders&#41;&#46;</p><p id="par0040" class="elsevierStylePara elsevierViewall">Demographic information biases were controlled through a questionnaire with closed questions applied by members of the <span class="elsevierStyleItalic">GIGHA</span>&#44; who received instructions and guidance from gastroenterologists and pathologists&#46; Histopathologic evaluation was validated by a second pathologist&#46;</p><p id="par0045" class="elsevierStylePara elsevierViewall">The molecular biology tests were performed according to worldwide accepted protocols&#46; Pilot tests were carried out to verify the quality of the reagents and the extraction kits and the laboratory equipment was previously calibrated&#46; Cases of bacterial coinfection determined through the presence of more than one genotype were excluded from the analysis to prevent interpretation bias of the genetic information and to calculate the true effect of each genotype on the response variable&#46;</p><p id="par0050" class="elsevierStylePara elsevierViewall">Because the variable of age had normal distribution through the Kolmogorov-Smirnov test&#44; it was presented as mean and standard deviation&#46; The differences between the means were evaluated using the Student&#39;s t test&#44; whereas the differences in proportions were evaluated through the chi-square test of independence&#46; The OR and its p value were used to evaluate the effect of each study variable on the response variable &#40;follicular gastritis&#41;&#46; A multivariate logistic regression analysis was carried out&#44; with sex and age as possible confounders&#46; Statistical significance was set at a p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#46; The statistical analysis was performed using the SPSS version 23 program&#46;</p><p id="par0055" class="elsevierStylePara elsevierViewall">The participants agreed to partake in the study and signed statements of informed consent&#46; The study was approved by the Ethics Committee for Scientific Research of the <span class="elsevierStyleItalic">Universidad del Cauca</span>&#46;</p></span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Results</span><p id="par0060" class="elsevierStylePara elsevierViewall">From a total of 808 participants selected within the study time frame&#44; 119 patients met the inclusion criteria&#46; Of those patients&#44; 83 corresponded to the 70&#37; that had nonatrophic gastritis and 36 to the 30&#37; diagnosed with follicular gastritis&#46; The age range in the patients with nonatrophic gastritis was 19 to 81 years&#44; with a mean of 44&#46;11 years&#46; The age range in the patients with follicular gastritis was 21 to 82 years&#44; with a mean of 41&#46;86 years&#46; The Student&#39;s t test showed no significant differences in the comparison of age means &#40;p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;48&#41;&#46; In relation to ethnicity&#44; the large majority of patients were mestizos&#44; but there were 6 &#40;17&#37;&#41; black patients in the follicular gastritis group&#46; No statistically significant differences in the sociodemographic variables were found &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0015"></elsevierMultimedia><p id="par0065" class="elsevierStylePara elsevierViewall">The relation between <span class="elsevierStyleItalic">H&#46; pylori</span> infection and the follicular inflammatory response was evaluated in the histopathologic study&#46; Thirty-five patients &#40;97&#46;2&#37;&#41; in the follicular gastritis group had the infection&#44; whereas only 60 &#40;72&#46;3&#37;&#41; patients in the control group presented with it&#46; There was a statistically significant association between infection and follicular gastritis&#59; OR&#58; 13&#46;41&#44; IC &#40;1&#46;7-103&#41; p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#46;</p><p id="par0070" class="elsevierStylePara elsevierViewall">A statistically significant association also was found in the evaluated relation between bacterial infection and inflammatory activity &#40;OR&#58; 337&#46;33&#44; IC&#58; &#91;53&#46;1-2142&#93;&#44; p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;00&#41;&#46;</p><p id="par0075" class="elsevierStylePara elsevierViewall">Follicular gastritis was classified as Wotherspoon grade 2 gastritis in the majority of the case group patients &#40;23&#47;36&#41;&#44; as grade 3 gastritis in 12 of the case patients &#40;33&#37;&#41;&#44; and as grade 4 gastritis in only one case patient&#46; By sex&#44; 6 men and 17 women had grade 2 gastritis&#44; 6 men and 6 women presented with grade 3&#44; and one woman&#44; 42 years old&#44; had grade 4&#46; There were no documented cases of MALT lymphoma&#46;</p><p id="par0080" class="elsevierStylePara elsevierViewall">Of the total of 119 participants&#44; 46 patients were excluded from the genetic analysis&#58; more than one vacA bacterial genotype &#40;coinfection&#41; was found in 20 patients and gene amplification was not achieved in 26 patients &#40;<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0020"></elsevierMultimedia><p id="par0085" class="elsevierStylePara elsevierViewall">Through molecular testing&#44; the <span class="elsevierStyleItalic">H&#46; pylori</span> of 73 participants &#40;50 patients with nonatrophic gastritis and 23 patients with follicular gastritis&#41; was characterized&#46; Regarding the distribution of the strains&#44; 29 &#40;58&#37;&#41; patients in the control group were positive for the cagA genotype&#44; whereas in the follicular gastritis group that genotype was described in 13 &#40;56&#46;5&#37;&#41; patients&#46; No statistically significant differences were found in relation to the cagA genotype &#40;the OR for developing follicular gastritis in cagA&#43;<span class="elsevierStyleHsp" style=""></span>patients was 0&#46;79&#44; CI<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;29-2&#46;13&#44; and p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;64&#41;&#46;</p><p id="par0090" class="elsevierStylePara elsevierViewall">In the patients with follicular gastritis&#44; 8 &#40;34&#46;8&#37;&#41; were iceA1 positive&#44; whereas in the control group that genotype was found in 13 &#40;26&#37;&#41; patients&#46; Those differences were not statistically significant &#40;OR&#58; 1&#46;83&#44; CI&#58; 0&#46;64-5&#46;22&#44; p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;26&#41;&#46; The s1&#44; s2&#44; m1&#44; and m2 subtypes were determined in the vacA bacterial genotype analysis and they were grouped into 4 categories&#44; according to their virulent profile&#46; Those groups were then related to the other genotypes &#40;iceA1 and cagA&#41;&#46; The cagA&#8211;&#47;iceA1&#8211; genotypes and the vacA s2&#47;m2 subtypes were selected as contrast groups&#46; The analysis showed a high prevalence &#40;82&#37;&#41; of the vacA s1&#47;m1 subtypes for the 2 patient groups with no significant differences &#40;OR&#58; 1&#46;04&#44; CI&#58; 0&#46;28-3&#46;81&#44; p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;95&#41;&#46;</p><p id="par0095" class="elsevierStylePara elsevierViewall">The s2&#47;m1 subtypes were not documented in either of the 2 groups and the analysis of the rest of the subtypes produced no statistically significant differences &#40;<a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0025"></elsevierMultimedia><p id="par0100" class="elsevierStylePara elsevierViewall">Even though the bivariate analysis showed no statistically significant associations between follicular gastritis and the age and sex variables&#44; a review of the literature revealed a probable relation to the response variable&#46; Therefore&#44; the possible confounding effect of those variables was examined in a logistic regression model that included <span class="elsevierStyleItalic">H&#46; pylori</span> infection &#40;<a class="elsevierStyleCrossRef" href="#tbl0030">Table 6</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0030"></elsevierMultimedia></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Discussion and conclusion</span><p id="par0105" class="elsevierStylePara elsevierViewall">The relation between follicular gastritis and age has been referenced by various authors&#46;<a class="elsevierStyleCrossRefs" href="#bib0215"><span class="elsevierStyleSup">3&#44;8&#44;17</span></a> Even though a young adult population would be expected in our study &#40;given that patients with the advanced age-related conditions of atrophy&#44; metaplasia&#44; dysplasia&#44; and cancer were excluded&#41;&#44;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">18</span></a> the age range of the participants was from 19 to 82 years&#46; Our results showed that&#44; in general terms&#44; the population with follicular gastritis was younger than the patients with chronic gastritis&#46; That finding is similar to results published by other authors&#46;<a class="elsevierStyleCrossRefs" href="#bib0295"><span class="elsevierStyleSup">19&#44;20</span></a></p><p id="par0110" class="elsevierStylePara elsevierViewall">The association between patterns of inflammatory response and ethnicity has been reported as an important risk factor for or protective factor against different diseases&#44; including gastric cancer&#46;<a class="elsevierStyleCrossRefs" href="#bib0305"><span class="elsevierStyleSup">21&#8211;23</span></a> For example&#44; the risk for gastric cancer and gastric inflammation grade have recently been proposed to be a product of a phenomenon of immunologic tolerance that is dependent on the population ancestry and the bacterial ancestry of <span class="elsevierStyleItalic">H&#46; pylori</span>&#46;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">22</span></a> Our study participants&#44; as well as their parents&#44; were born in the Cauca department&#44; and the majority of the patients with follicular gastritis were mestizo&#46; Given the small number of patients in the present study&#44; our conclusions are limited&#44; but that finding is interesting&#44; since it suggests the possibility that population ancestry and ethnic origin could influence the follicular inflammation pattern&#44; something that has not been described in the literature&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">The prevalence of <span class="elsevierStyleItalic">Helicobacte</span>r infection in patients with follicular gastritis varies between 68&#37; and 100&#37;&#44; in accordance with the number of biopsies taken&#46;<a class="elsevierStyleCrossRefs" href="#bib0245"><span class="elsevierStyleSup">9&#44;24</span></a> The Sydney protocol was applied in the present study&#44; which stipulates taking 5 biopsies&#44; enabling significant sampling of the gastric mucosa and a reliable histologic determination&#46;<a class="elsevierStyleCrossRef" href="#bib0325"><span class="elsevierStyleSup">25</span></a> Infection was detected through microscopic study in 97&#46;2&#37; of the patients with follicular gastritis&#44; showing a significant difference with the control group &#40;OR&#58; 13&#46;41&#44; CI&#58;1&#46;7-103&#44; p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#46; That relation even persisted in the multivariate model that included the confounding variables&#46; Likewise&#44; a significant association was shown between inflammatory activity and the presence of bacterial infection&#46; The link between infection and active follicular gastritis is widely recognized in the medical community and has been documented by different researchers&#46;<a class="elsevierStyleCrossRefs" href="#bib0215"><span class="elsevierStyleSup">3&#44;5&#44;26&#44;27</span></a></p><p id="par0120" class="elsevierStylePara elsevierViewall">The role of bacterial genotypes in relation to MALT lymphoma has been evaluated in different studies&#46; In their analyses&#44; Eck&#44; Ye&#44; and Koehler&#44; et al&#46;&#44; were able to establish statistically significant associations between lymphoma and the cagA&#44; vacAs1&#47;m1&#44; and iceA1 genotypes&#46;<a class="elsevierStyleCrossRefs" href="#bib0340"><span class="elsevierStyleSup">28&#8211;30</span></a> However&#44; there are few studies that relate bacterial genotypes and follicular gastritis&#46; Specifically&#44; Soltermann et al&#46; evaluated the presence of lymphoid follicles in the antrum and corpus and correlated the information with the cagA and vacA alleles and genotypes&#44; demonstrating no significant relation&#46;<a class="elsevierStyleCrossRef" href="#bib0355"><span class="elsevierStyleSup">31</span></a> Those findings were similar to ours&#46; Other descriptive and analytic studies have been conducted in Latin America that show associations between bacterial genotypes and the pathologies of ulcer&#44; cancer&#44; and gastritis&#46;<a class="elsevierStyleCrossRefs" href="#bib0360"><span class="elsevierStyleSup">32&#8211;35</span></a> To the best of our knowledge&#44; the present study is the first to examine the relation of bacterial genotypes to follicular gastritis in a Colombian population&#46;</p><p id="par0125" class="elsevierStylePara elsevierViewall">In Colombia&#44; Quiroga and Citelly reported cagA genotype frequencies of 50&#37; and 51&#46;4&#37; in patients with gastritis&#44;<a class="elsevierStyleCrossRefs" href="#bib0375"><span class="elsevierStyleSup">35&#44;36</span></a> figures similar to that found in the present study &#40;58&#37; in the controls&#41;&#46;</p><p id="par0130" class="elsevierStylePara elsevierViewall">In relation to the vacAs1&#47;m1 genotypes in the study by Citelly et al&#46;&#44; they showed a prevalence of 43&#37; for the s1 strain and of 40&#37; for the m1 strain&#44; whereas prevalence in our findings was above 80&#37;&#46; That information signifies that our study population had more aggressive bacterial genotypes&#44; even at early gastric disease stages&#46; It should be emphasized that none of the patients in the present study had atrophy&#44; metaplasia&#44; or dysplasia&#44; and that the majority of patients in the case group presented with grade 2 or 3 follicular gastritis&#46; In accordance with the knowledge there is on the cascades involved in carcinogenesis proposed by Pelayo Correa&#44; and with the Wotherspoon model&#44;<a class="elsevierStyleCrossRefs" href="#bib0280"><span class="elsevierStyleSup">16&#44;37</span></a> the histologic findings in our study population would suggest a low risk for the development of cancer &#40;both intestinal adenocarcinoma and MALT lymphoma&#41;&#44; but the presence of cytotoxic strains would make a more careful endoscopic and histopathologic follow-up of our patients a necessity&#46; Those genotypic differences would explain&#44; at least partially&#44; why patients from the Cauca department have higher incidence rates of cancer&#44; compared with other areas of the country&#46;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">15</span></a></p><p id="par0135" class="elsevierStylePara elsevierViewall">The iceA1 genotype is considered by some authors to be a virulence factor involved in the cellular adhesion and development of ulcers&#44; whereas others believe its prevalence depends on the geographic distribution of the bacterium&#46;<a class="elsevierStyleCrossRefs" href="#bib0390"><span class="elsevierStyleSup">38&#8211;40</span></a> In the present study&#44; there was no significant change in the distribution of the iceA1 genotype between the groups compared&#44; but it was more frequent in the follicular gastritis group than in the nonatrophic gastritis group&#46; Those data suggest a probable relation between the follicular inflammatory response and the iceA1 genotype&#46;</p><p id="par0140" class="elsevierStylePara elsevierViewall">The reduced number of data included for the genetic analyses was one of the limitations of our study&#46; The verification of pH in the formalin utilized for biopsy collection or the use of transport means and culture methods as alternatives for facilitating bacterial DNA recovery are suggested for future studies&#46; We hope to motivate the scientific community to evaluate the role of the iceA1 genotype&#44; using larger sample sizes&#46;</p><p id="par0145" class="elsevierStylePara elsevierViewall">In conclusion&#44; our study results showed that follicular gastritis and inflammatory activity are reliable markers for the presence of <span class="elsevierStyleItalic">H&#46; pylori</span> infection and that the genotypes with a high oncogenic risk predominated in the study population&#46; Therefore&#44; its diagnosis should alert the clinician&#44; so that progression to diseases with greater morbidity and mortality is prevented&#46; In addition&#44; it was suggested that the iceA genotype could play a role in the development of follicular gastritis&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Ethical disclosures</span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Protection of human and animal subjects</span><p id="par0150" class="elsevierStylePara elsevierViewall">The authors declare that no experiments were performed on humans or animals for this study&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Confidentiality of data</span><p id="par0155" class="elsevierStylePara elsevierViewall">The authors declare that they have followed the protocols of their work center on the publication of patient data&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Right to privacy and informed consent</span><p id="par0160" class="elsevierStylePara elsevierViewall">The authors have obtained the written informed consent of the patients and&#47;or subjects mentioned in the article&#46;</p></span></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Financial disclosure</span><p id="par0165" class="elsevierStylePara elsevierViewall">The present study was financed by the <span class="elsevierStyleItalic">Programa de Salud de Colciencias</span>&#44; project code 1103-519-29123&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Conflict of interest</span><p id="par0170" class="elsevierStylePara elsevierViewall">The authors of the present article declare that there is no conflict of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:13 [
        0 => array:3 [
          "identificador" => "xres1208066"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Introduction and objective"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Materials and methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusions"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1124979"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1208067"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Introducci&#243;n y objetivo"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Material y m&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Conclusiones"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1124980"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction and aims"
        ]
        5 => array:2 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
        ]
        6 => array:2 [
          "identificador" => "sec0015"
          "titulo" => "Results"
        ]
        7 => array:2 [
          "identificador" => "sec0020"
          "titulo" => "Discussion and conclusion"
        ]
        8 => array:3 [
          "identificador" => "sec0025"
          "titulo" => "Ethical disclosures"
          "secciones" => array:3 [
            0 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Protection of human and animal subjects"
            ]
            1 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Confidentiality of data"
            ]
            2 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Right to privacy and informed consent"
            ]
          ]
        ]
        9 => array:2 [
          "identificador" => "sec0050"
          "titulo" => "Financial disclosure"
        ]
        10 => array:2 [
          "identificador" => "sec0055"
          "titulo" => "Conflict of interest"
        ]
        11 => array:2 [
          "identificador" => "xack412714"
          "titulo" => "Acknowledgements"
        ]
        12 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2018-02-10"
    "fechaAceptado" => "2018-03-27"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1124979"
          "palabras" => array:5 [
            0 => "<span class="elsevierStyleItalic">Helicobacter pylori</span>"
            1 => "Gastritis"
            2 => "Mucosa-associated lymphoid tissue"
            3 => "Genotype"
            4 => "Lymphoma"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1124980"
          "palabras" => array:5 [
            0 => "<span class="elsevierStyleItalic">Helicobacter pylori</span>"
            1 => "Gastritis"
            2 => "Tejido linfoide asociado a mucosas"
            3 => "Genotipo"
            4 => "Linfoma"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Introduction and objective</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Follicular gastritis is associated with <span class="elsevierStyleItalic">Helicobacter pylori</span> infection&#44; but little is known of its relation to bacterial genotypes&#46; Our aim was to establish the relation between follicular gastritis and different <span class="elsevierStyleItalic">H&#46; pylori</span> strains<span class="elsevierStyleItalic">&#46;</span></p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Materials and methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">An analytic case-control study was conducted that included 36 patients with follicular gastritis &#40;cases&#41; and 83 with nonatrophic gastritis &#40;controls&#41;&#46; The sociodemographic information was obtained through a questionnaire&#46; Biopsies were evaluated according to the Sydney System and the Wotherspoon scoring system&#46; <span class="elsevierStyleItalic">Helicobacter pylori</span> genotyping was performed using the polymerase chain reaction technique&#46; The quantitative variables were presented as mean and standard deviation and the qualitative variables as proportions and absolute frequency&#46; The effect of each variable on outcome &#40;follicular gastritis&#41; was evaluated through the odds ratio and its 95&#37; confidence interval&#46; Statistical significance was set at a <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">Follicular gastritis was associated with <span class="elsevierStyleItalic">Helicobacter pylori</span> infection &#40;OR&#58; 13&#46;41&#44; CI&#58; 1&#46;7-103&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#46; The CagA&#43; genotype was present in 56&#46;5&#37; of the cases and 58&#37; of the controls&#46; The cytotoxic VacAs1m1strain was present in 82&#37; of the isolates in both groups&#46; IceA1 frequency was 34&#46;8&#37; in the cases and 26&#37; in the controls and the difference was not statistically significant&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusions</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">The population studied had elevated frequencies of cytotoxic <span class="elsevierStyleItalic">Helicobacter pylori</span> strains and the iceA1 genotype was more frequent in follicular gastritis&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Introduction and objective"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Materials and methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusions"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Introducci&#243;n y objetivo</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">La gastritis folicular se asocia con la infecci&#243;n por <span class="elsevierStyleItalic">Helicobacter pylori&#59;</span> sin embargo&#44; su relaci&#243;n con los genotipos bacterianos es poco conocida&#46; Nuestro objetivo fue establecer la relaci&#243;n entre la gastritis folicular y distintas cepas del <span class="elsevierStyleItalic">H&#46; pylori&#46;</span></p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Material y m&#233;todos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">Estudio anal&#237;tico de casos y controles que incluy&#243; 36 pacientes con gastritis folicular &#40;casos&#41; y 83 con gastritis no atr&#243;fica &#40;controles&#41;&#46; La informaci&#243;n sociodemogr&#225;fica se obtuvo mediante un cuestionario&#46; Se obtuvieron biopsias que se evaluaron seg&#250;n las clasificaciones de Sydney y Wotherspoon&#46; La genotipificaci&#243;n de <span class="elsevierStyleItalic">H&#46; pylori</span> se realiz&#243; mediante reacci&#243;n en cadena de la polimerasa&#46; Para las variables cuantitativas se emple&#243; la media y la desviaci&#243;n est&#225;ndar&#46; Las variables categ&#243;ricas se presentan como proporciones y frecuencia absoluta&#46; La OR con su IC del 95&#37; evalu&#243; el efecto de cada variable sobre el desenlace &#40;gastritis folicular&#41;&#46; Un valor de p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 se consider&#243; significativo&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">La gastritis folicular se asoci&#243; con la infecci&#243;n por <span class="elsevierStyleItalic">Helicobacter</span> OR&#58; 13&#46;41 IC &#40;1&#46;7-103&#41; p<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#46; El genotipo CagA&#43; estuvo presente en el 56&#46;5&#37; de los casos y 58&#37; de los controles&#46; El 82&#37; de los aislamientos present&#243; la cepa citot&#243;xica VacAs1m1 en los 2 grupos&#46; La frecuencia de iceA1 fue de 34&#46;8&#37; y 26&#37; en casos y controles respectivamente&#44; diferencias que no fueron estad&#237;sticamente significativas&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusiones</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Las cepas citot&#243;xicas de <span class="elsevierStyleItalic">Helicobacter</span> exhiben elevadas frecuencias en la poblaci&#243;n estudiada&#46; El genotipo iceA1 fue m&#225;s frecuente en la gastritis folicular&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Introducci&#243;n y objetivo"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Material y m&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Conclusiones"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:2 [
        "etiqueta" => "&#9734;"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0010">Please cite this article as&#58; Carlosama-Rosero YH&#44; Bola&#241;os-Bravo H&#44; Sierra-T&#243;rres CH&#44; Rosero EA&#46; Asociaci&#243;n de los genotipos cagA&#44; vacA e IceA de <span class="elsevierStyleItalic">H&#46; pylori</span> con la gastritis cr&#243;nica y folicular en una poblaci&#243;n colombiana con alto riesgo de c&#225;ncer g&#225;strico&#46; Revista de Gastroenterolog&#237;a de M&#233;xico&#46; 2019&#59;84&#58;158&#8211;164&#46;</p>"
      ]
    ]
    "multimedia" => array:6 [
      0 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Source&#58; Modified from Wotherspoon et al&#46;<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">16</span></a></p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Grade 0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Normal&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Scant inflammatory cells in the lamina propria&#46; No lymphoid follicles&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Grade 1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Chronic gastritis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Small clusters of lymphocytes in the lamina propria&#46; No lymphoid follicles&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Grade 2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Follicular gastritis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Prominent lymphoid follicles with plasma cells and mantle zone&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Grade 3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Suspicious&#44; probably reactive&#44; inflammatory infiltrate&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Lymphoid follicles surrounded by small lymphocytes that diffusely infiltrate the lamina propria and occasionally the epithelium&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Grade 4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Suspicious infiltrate&#44; probably lymphoma&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Lymphoid follicles surrounded by centrocyte-like cells that infiltrate the lamina propria and the epithelium in small groups&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Grade 5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">MALT lymphoma&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Presence of a dense infiltrate of centrocyte-like mononuclear cells in the lamina propria that invade the epithelial lamina&#8212;lymphoepithelial lesion&#8212;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2062071.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Follicular gastritis severity grade&#44; including the suspicious MALT lymphoma grade&#46;</p>"
        ]
      ]
      1 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Genes and regions&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Sequence &#40;5&#8242;&#8594;3&#8242;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Size &#40;bp&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">cag</span>A&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GATAACAGGCAAGCTTTTGAGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">349&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CGTCAAAAGATTGTTTGGCAGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">ice</span>A1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTGTTTTTAACCAAAGTATC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">247&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTATAGCCASTYTCTTTGCA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">vac</span>A s1&#47;s2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ATGGAAATACAACAAACACAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">259&#47;286&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTGCTTGAATGCGCCAAAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">vac</span>A m1&#47;m2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CAATCTGTCCAATCAAGCGAG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">570&#47;645&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCGTCTAAATAATTCCAAGG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2062074.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Sequence of primers for amplification through PCR&#46;</p>"
        ]
      ]
      2 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">MMW&#58; monthly minimum wage&#59; NA&#58; not applicable&#46;</p><p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">P values &#60; 0&#46;05 are statistically significant&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">N<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>119</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Chronic gastritis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Follicular gastritis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " colspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variables</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">CI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Coded age</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Greater than or equal to 40 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">47 &#40;56&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17 &#40;47&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Under 40 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">36 &#40;43&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19 &#40;52&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;0&#46;66-3&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;34&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Sex</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Male&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">56 &#40;67&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24 &#40;66&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Female&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">27 &#40;32&#46;5&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12 &#40;33&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;0&#46;45-2&#46;38&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;93&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Educational level</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Technical or higher education&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;33&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;22&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">None to middle school&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">55 &#40;66&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28 &#40;77&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;78&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;0&#46;71-4&#46;41&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;21&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="2" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Income category</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#62; a 1 MMW&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40 &#40;48&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17 &#40;47&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#60; a 1 MMW&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">43 &#40;51&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19 &#40;52&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;0&#46;47-2&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;92&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " rowspan="5" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Ethnic group</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Amerindian&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;1&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;5&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">White&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5 &#40;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Black&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;1&#46;2&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;16&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;0&#46;12-73&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mestizo&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">76 &#40;91&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">27 &#40;75&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#40;0&#46;01-2&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;16&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mulatto&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0 &#40;0&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;2&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">NA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2062073.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Sociodemographic characteristics of the patients&#46;</p>"
        ]
      ]
      3 => array:8 [
        "identificador" => "tbl0020"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at4"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">PCR&#58; polymerase chain reaction&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Nonatrophic gastritis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col">Follicular gastritis&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">N<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>83 &#40;&#37;&#41;<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">&#42;</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">N<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>36 &#40;&#37;&#41;<a class="elsevierStyleCrossRef" href="#tblfn0005"><span class="elsevierStyleSup">&#42;</span></a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Coinfection&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14 &#40;16&#46;9&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;16&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Not amplified by PCR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19 &#40;22&#46;9&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;19&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2062070.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Percentage within each study group&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Genetic information not included in the analysis due to bacterial coinfection and absence of amplification&#46;</p>"
        ]
      ]
      4 => array:8 [
        "identificador" => "tbl0025"
        "etiqueta" => "Table 5"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at5"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">P values &#60; 0&#46;05 are statistically significant&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Genotype&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Chronic gastritis&#44; n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Follicular gastritis&#44; n &#40;&#37;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">CI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CagA-&#47;IceA&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">17 &#40;34&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8 &#40;34&#46;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CagA-&#47;IceA&#43;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4 &#40;8&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;8&#46;7&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;16-7&#46;06&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;95&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CagA&#43;&#47;IceA-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20 &#40;40&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;30&#46;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;74&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;22-2&#46;47&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;63&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CagA&#43;&#47;IceA&#43;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">9 &#40;18&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6 &#40;26&#46;1&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;41&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;37-5&#46;38&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;61&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">VacA-s2m2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7 &#40;14&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1 &#40;4&#46;3&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">VacA-s1m2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2 &#40;4&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3 &#40;13&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">10&#46;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;67-165&#46;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;09&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">VacA-s1m1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">41 &#40;82&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">19 &#40;82&#46;6&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;24&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;37-28&#46;26&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2062075.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0085" class="elsevierStyleSimplePara elsevierViewall">Distribution of the cagA&#44; iceA1&#44; and vacA genotypes in the study groups&#59; n<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>73&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0030"
        "etiqueta" => "Table 6"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at6"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0100" class="elsevierStyleSimplePara elsevierViewall">P values &#60; 0&#46;05 are statistically significant&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Variable&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Crude OR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">CI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Adjusted OR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">CI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Age under 40 years&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;66-3&#46;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;34&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;26&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;44-3&#46;62&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;66&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Female sex&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;03&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;45-2&#46;38&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;93&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;27&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;43-3&#46;8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;66&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Helicobacter pylori</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">13&#46;41&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;7-103&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;01&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">8&#46;7&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;1-70&#46;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;04&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2062072.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0095" class="elsevierStyleSimplePara elsevierViewall">Multivariate model adjusted by categorized age and by sex&#46; The measures of association of the variables of interest in relation to outcome &#40;follicular gastritis&#41; are shown&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:40 [
            0 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gastric lymphoid follicles in Helicobacter pylori infection&#58; Frequency&#44; distribution&#44; and response to triple therapy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R&#46;M&#46; Genta"
                            1 => "H&#46;W&#46; Hamner"
                            2 => "D&#46;Y&#46; Graham"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Human Pathol"
                        "fecha" => "1993"
                        "volumen" => "24"
                        "paginaInicial" => "577"
                        "paginaFinal" => "583"
                        "itemHostRev" => array:3 [
                          "pii" => "S021391111100255X"
                          "estado" => "S300"
                          "issn" => "02139111"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Helicobacter pylori infection and chronic gastritis&#58; Clinical&#44; serological&#44; and histologic correlations in children treated with amoxicillin and colloidal bismuth subcitrate"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "C&#46; De Giacomo"
                            1 => "R&#46; Fiocca"
                            2 => "L&#46; Villani"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "J Pediatr Gastroenterol Nutr"
                        "fecha" => "1990"
                        "volumen" => "11"
                        "paginaInicial" => "310"
                        "paginaFinal" => "316"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/2246711"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Follicular gastritis associated with Helicobacter pylori"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "Z&#46; Ma"
                            1 => "T&#46; Tanizawa"
                            2 => "Z&#46; Nihei"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Med Dental Sci"
                        "fecha" => "2000"
                        "volumen" => "47"
                        "paginaInicial" => "39"
                        "paginaFinal" => "47"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Predictive factors and prevalence of follicular gastritis in adults with peptic ulcer and nonulcer dyspepsia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "S&#46;D&#46; Ladas"
                            1 => "T&#46; Rokkas"
                            2 => "S&#46; Georgopoulos"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Dig Dis Sci"
                        "fecha" => "1999"
                        "volumen" => "44"
                        "paginaInicial" => "1156"
                        "paginaFinal" => "1160"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10389688"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Follicular gastritis in adults"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "F&#46; Zerbib"
                            1 => "G&#46; Vialette"
                            2 => "R&#46; Cayla"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Relations with Helicobacter pylori&#44; histological and endoscopic aspects&#46; Gastroenterologie clinique et biologique"
                        "fecha" => "1993"
                        "volumen" => "17"
                        "paginaInicial" => "529"
                        "paginaFinal" => "534"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8253308"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of lymphoid follicles and aggregates in Helicobacter pylori gastritis in antral and body mucosa"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "S&#46; Eidt"
                            1 => "M&#46; Stolte"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/jcp.46.9.832"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Pathol"
                        "fecha" => "1993"
                        "volumen" => "46"
                        "paginaInicial" => "832"
                        "paginaFinal" => "835"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8227434"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The significance of lymphoid follicles in the interpretation of gastric biopsy specimens"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "R&#46;M&#46; Genta"
                            1 => "H&#46;W&#46; Hamner"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Arch Pathol Lab Med"
                        "fecha" => "1994"
                        "volumen" => "118"
                        "paginaInicial" => "740"
                        "paginaFinal" => "743"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7517659"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Helicobacter pylori associated gastric diseases and lymphoid tissue hyperplasia in gastric antral mucosa"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "X&#46; Chen"
                            1 => "W&#46; Liu"
                            2 => "Y&#46; Shi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/jcp.55.2.133"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Pathol"
                        "fecha" => "2002"
                        "volumen" => "55"
                        "paginaInicial" => "133"
                        "paginaFinal" => "137"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11865009"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hiperplasia linfoide folicular g&#225;strica e infecci&#243;n por Helicobacter pylori en adultos colombianos"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46;D&#46;M&#46; Mar&#237;n"
                            1 => "S&#46;C&#46;H&#46; Riveros"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Colomb Gastroenterol"
                        "fecha" => "2009"
                        "volumen" => "24"
                        "paginaInicial" => "148"
                        "paginaFinal" => "156"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gastric MALT lymphoma&#58; Old and new insights"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "A&#46; Zullo"
                            1 => "C&#46; Hassan"
                            2 => "L&#46; Ridola"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Gastroenterol"
                        "fecha" => "2014"
                        "volumen" => "27"
                        "paginaInicial" => "27"
                        "paginaFinal" => "33"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24714739"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Endoscopic nodular gastritis&#58; An endoscopic indicator of high-grade bacterial colonization and severe gastritis in children with Helicobacter pylori"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "M&#46;G&#46;S&#46; Bah&#250;"
                            1 => "T&#46;R&#46; da Silveira"
                            2 => "I&#46; Maguilnick"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Pediatr Gastroenterol Nutr"
                        "fecha" => "2003"
                        "volumen" => "36"
                        "paginaInicial" => "217"
                        "paginaFinal" => "222"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Helicobacter heilmannii&#8211;associated primary gastric low-grade MALT lymphoma&#58; Complete remission after curing the infection"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "A&#46; Morgner"
                            1 => "N&#46; Lehn"
                            2 => "L&#46;P&#46; Andersen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Gastroenterology"
                        "fecha" => "2000"
                        "volumen" => "118"
                        "paginaInicial" => "821"
                        "paginaFinal" => "828"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10784580"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "What role does Helicobacter pylori eradication play in gastric MALT and gastric MALT lymphoma&#63;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "C&#46; Thiede"
                            1 => "A&#46; Morgner"
                            2 => "B&#46; Alpen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Gastroenterology"
                        "fecha" => "1997"
                        "volumen" => "113"
                        "paginaInicial" => "61"
                        "paginaFinal" => "64"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Science&#44; medicine&#44; and the future&#58; Helicobacter pylori and gastric diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "M&#46;J&#46; Blaser"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Br Med J"
                        "fecha" => "1998"
                        "volumen" => "316"
                        "paginaInicial" => "1507"
                        "paginaFinal" => "1510"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Incidencia estimada y mortalidad por c&#225;ncer en Colombia 2002-2006&#46; Incidencia estimada y mortalidad por c&#225;ncer en Colombia 2002-2006"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "C&#46; Pardo Ramos"
                            1 => "R&#46; Cendales Duarte"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:4 [
                        "fecha" => "2010"
                        "paginaInicial" => "lil"
                        "paginaFinal" => "lil668548"
                        "editorial" => "Instituto Nacional de Cancerolog&#237;a"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Low-grade gastric B-cell lymphoma of mucosa-associated lymphoid tissue &#40;MALT&#41;&#58; A multifocal disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46; Wotherspoon"
                            1 => "C&#46; Doglioni"
                            2 => "P&#46; Isaacson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Histopathology"
                        "fecha" => "1992"
                        "volumen" => "20"
                        "paginaInicial" => "29"
                        "paginaFinal" => "34"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1737623"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A 2-year study of Helicobacter pylori in children"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "J&#46; Raymond"
                            1 => "M&#46; Bergeret"
                            2 => "P&#46; Benhamou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:7 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "1994"
                        "volumen" => "32"
                        "paginaInicial" => "461"
                        "paginaFinal" => "463"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/8150958"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0213911110000993"
                          "estado" => "S300"
                          "issn" => "02139111"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The corporal atrophic chronic gastritis and the age"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "J&#46;D&#46; Mart&#237;nez"
                            1 => "S&#46;C&#46; Henao"
                            2 => "C&#46; Granados"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Rev Colomb Gastroenterol"
                        "fecha" => "2007"
                        "volumen" => "22"
                        "paginaInicial" => "17"
                        "paginaFinal" => "22"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The prevalence of lymphoid follicles in Helicobacter pylori associated gastritis in patients with ulcers and non-ulcer dyspepsia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "A&#46; Zaitoun"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/jcp.48.4.325"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Pathol"
                        "fecha" => "1995"
                        "volumen" => "48"
                        "paginaInicial" => "325"
                        "paginaFinal" => "329"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/7615851"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Clinical and pathological features of nodular gastritis in adults"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "I&#46;K&#46; &#214;nal"
                            1 => "C&#46; S&#246;kmens&#252;er"
                            2 => "E&#46;D&#46; &#214;nal"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Turkish J Med Sci"
                        "fecha" => "2009"
                        "volumen" => "39"
                        "paginaInicial" => "719"
                        "paginaFinal" => "723"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Ethnic difference of Helicobacter pylori gastritis&#58; Korean and Japanese gastritis is characterized by male-and antrum-predominant acute foveolitis in comparison with American gastritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "I&#46; Lee"
                            1 => "H&#46; Lee"
                            2 => "M&#46; Kim"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3748/wjg.v11.i1.94"
                      "Revista" => array:6 [
                        "tituloSerie" => "World J Gastroenterol"
                        "fecha" => "2005"
                        "volumen" => "11"
                        "paginaInicial" => "94"
                        "paginaFinal" => "98"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15609404"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Human and Helicobacter pylori coevolution shapes the risk of gastric disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "N&#46; Kodaman"
                            1 => "A&#46; Pazos"
                            2 => "B&#46;G&#46; Schneider"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Proceed Nat Acad Sci"
                        "fecha" => "2014"
                        "volumen" => "111"
                        "paginaInicial" => "1455"
                        "paginaFinal" => "1460"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Helicobacter pylori&#58; The African enigma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "I&#46; Segal"
                            1 => "R&#46; Ally"
                            2 => "F&#46; Sitas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Gut"
                        "fecha" => "1998"
                        "volumen" => "43"
                        "paginaInicial" => "300"
                        "paginaFinal" => "301"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Chronic gastritis and Helicobacter pylori&#58; A histopathological study of gastric mucosal biopsies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;Y&#46; Yakoob"
                            1 => "A&#46;S&#46; Hussainy"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Coll Phys Surg Pakistan"
                        "fecha" => "2010"
                        "volumen" => "20"
                        "paginaInicial" => "773"
                        "paginaFinal" => "775"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Fuentes de variabilidad en el diagn&#243;stico de gastritis atr&#243;fica multifocal asociada con la infecci&#243;n por Helicobacter pylori"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "L&#46;E&#46; Bravo"
                            1 => "J&#46;C&#46; Bravo"
                            2 => "J&#46;L&#46; Realpe"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Colombia M&#233;dica"
                        "fecha" => "2008"
                        "volumen" => "39"
                        "paginaInicial" => "58"
                        "paginaFinal" => "65"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25267864"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association between follicular gastritis and Helicobacter pylori in children seen at a public hospital in Peru"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "C&#46; Mejia"
                            1 => "C&#46; Vera"
                            2 => "L&#46; Huiza-Espinoza"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Gastroenterol M&#233;xico &#40;English ed&#41;"
                        "fecha" => "2016"
                        "volumen" => "81"
                        "paginaInicial" => "80"
                        "paginaFinal" => "85"
                        "itemHostRev" => array:3 [
                          "pii" => "S0213911114000806"
                          "estado" => "S300"
                          "issn" => "02139111"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "A&#46; Wotherspoon"
                            1 => "C&#46; Ortiz Hidalgo"
                            2 => "M&#46; Falzon"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "The Lancet"
                        "fecha" => "1991"
                        "volumen" => "338"
                        "paginaInicial" => "1175"
                        "paginaFinal" => "1176"
                        "itemHostRev" => array:3 [
                          "pii" => "S1885585714000267"
                          "estado" => "S300"
                          "issn" => "18855857"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Helicobacter pylori genotyping in gastric adenocarcinoma and MALT lymphoma by multiplex PCR analyses of paraffin wax embedded tissues"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "C&#46; Koehler"
                            1 => "M&#46; Mues"
                            2 => "H&#46; Dienes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Molecular Pathol"
                        "fecha" => "2003"
                        "volumen" => "56"
                        "paginaInicial" => "36"
                        "paginaFinal" => "42"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "MALT-type lymphoma of the stomach is associated with Helicobacter pylori strains expressing the CagA protein"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "M&#46; Eck"
                            1 => "B&#46; Schmausser"
                            2 => "R&#46; Haas"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Gastroenterology"
                        "fecha" => "1997"
                        "volumen" => "112"
                        "paginaInicial" => "1482"
                        "paginaFinal" => "1486"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9136825"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Variable frequencies of t &#40;11&#59; 18&#41;&#40;q21&#59; q21&#41; in MALT lymphomas of different sites&#58; Significant association with CagA strains of H pylori in gastric MALT lymphoma"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "H&#46; Ye"
                            1 => "H&#46; Liu"
                            2 => "A&#46; Attygalle"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1182/blood-2002-11-3502"
                      "Revista" => array:6 [
                        "tituloSerie" => "Blood"
                        "fecha" => "2003"
                        "volumen" => "102"
                        "paginaInicial" => "1012"
                        "paginaFinal" => "1018"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12676782"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Correlation of Helicobacter pylori virulence genotypes vacA and cagA with histological parameters of gastritis and patient&#39;s age"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "A&#46; Soltermann"
                            1 => "S&#46; Koetzer"
                            2 => "F&#46; Eigenmann"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Modern Pathol"
                        "fecha" => "2007"
                        "volumen" => "20"
                        "paginaInicial" => "878"
                        "paginaFinal" => "883"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Relationship between Helicobacter pylori iceA&#44; cagA&#44; and vacA status and clinical outcome&#58; Studies in four different countries"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "Y&#46; Yamaoka"
                            1 => "T&#46; Kodama"
                            2 => "O&#46; Gutierrez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Clin Microbiol"
                        "fecha" => "1999"
                        "volumen" => "37"
                        "paginaInicial" => "2274"
                        "paginaFinal" => "2279"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of cagA and vacA genes in isolates from patients with Helicobacter pylori-associated gastroduodenal diseases in Recife&#44; Pernambuco&#44; Brazil"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "C&#46;A&#46; Brito"
                            1 => "L&#46; Silva"
                            2 => "N&#46; Juc&#225;"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/s0074-02762003000600018"
                      "Revista" => array:6 [
                        "tituloSerie" => "Memorias do Instituto Oswaldo Cruz"
                        "fecha" => "2003"
                        "volumen" => "98"
                        "paginaInicial" => "817"
                        "paginaFinal" => "821"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/14595461"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Frequency of vacA&#44; cagA and babA2 virulence markers in Helicobacter pylori strains isolated from Mexican patients with chronic gastritis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "G&#46;L&#46; Paniagua"
                            1 => "E&#46; Monroy"
                            2 => "R&#46; Rodriguez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Annals Clin Microbiol Antimicrob"
                        "fecha" => "2009"
                        "volumen" => "8"
                        "paginaInicial" => "14"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genotyping of Helicobacter pylori virulence factors vacA and cagA in individuals from two regions in Colombia with opposing risk for gastric cancer"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "E&#46; Trujillo"
                            1 => "T&#46; Mart&#237;nez"
                            2 => "M&#46;M&#46; Bravo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1590/S0120-41572014000400009"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biom&#233;dica"
                        "fecha" => "2014"
                        "volumen" => "34"
                        "paginaInicial" => "567"
                        "paginaFinal" => "573"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25504245"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Helicobacter pylori genotypes in non atrophic gastritis are different of the found in peptic ulcer&#44; premalignant lesions and gastric cancer in Colombia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "D&#46; Cittelly"
                            1 => "M&#46; Huertas"
                            2 => "J&#46; Martinez"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Rev Med Chile"
                        "fecha" => "2002"
                        "volumen" => "130"
                        "paginaInicial" => "143"
                        "paginaFinal" => "151"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11974526"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Human gastric carcinogenesis&#58; A multistep and multifactorial process&#8211;first American Cancer Society award lecture on cancer epidemiology and prevention"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "P&#46; Correa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Cancer Res"
                        "fecha" => "1992"
                        "volumen" => "52"
                        "paginaInicial" => "6735"
                        "paginaFinal" => "6740"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/1458460"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "BabA2&#44; oipA and cagE Helicobacter pylori genotypes in Colombian patients with gastroduodenal diseases"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "A&#46;J&#46; Quiroga"
                            1 => "C&#46; Diana Marcela"
                            2 => "M&#46;M&#46; Bravo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Biom&#233;dica"
                        "fecha" => "2005"
                        "volumen" => "25"
                        "paginaInicial" => "325"
                        "paginaFinal" => "334"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16276680"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0395"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "H pylori iceA alleles are disease-specific virulence factors"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:3 [
                            0 => "V&#46; Caner"
                            1 => "M&#46; Yilmaz"
                            2 => "N&#46; Yonetci"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3748/wjg.v13.i18.2581"
                      "Revista" => array:6 [
                        "tituloSerie" => "World J Gastroenterol"
                        "fecha" => "2007"
                        "volumen" => "13"
                        "paginaInicial" => "2581"
                        "paginaFinal" => "2585"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/17552005"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            39 => array:3 [
              "identificador" => "bib0400"
              "etiqueta" => "40"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Helicobacter pylori virulence factors&#8211;one part of a big picture"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46; H&#246;cker"
                            1 => "P&#46; Hohenberger"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "The Lancet"
                        "fecha" => "2003"
                        "volumen" => "362"
                        "paginaInicial" => "1231"
                        "paginaFinal" => "1233"
                        "itemHostRev" => array:3 [
                          "pii" => "S0212656716302104"
                          "estado" => "S300"
                          "issn" => "02126567"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack412714"
        "titulo" => "Acknowledgements"
        "texto" => "<p id="par0175" class="elsevierStylePara elsevierViewall">The authors wish to thank the patients for their participation in the study and the personnel of the <span class="elsevierStyleItalic">Hospital Universitario San Jos&#233;</span> and <span class="elsevierStyleItalic">Endovideo</span> for their invaluable support&#46; In addition&#44; they wish to thank the <span class="elsevierStyleItalic">Laboratorio de Gen&#233;tica Humana</span> and the <span class="elsevierStyleItalic">Departamento de Patolog&#237;a</span> of the <span class="elsevierStyleItalic">Facultad de Ciencias de la Salud</span> of the <span class="elsevierStyleItalic">Universidad del Cauca</span> for their support in carrying out this project&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/2255534X/0000008400000002/v1_201906191703/S2255534X18301099/v1_201906191703/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "23968"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Original Articles"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/2255534X/0000008400000002/v1_201906191703/S2255534X18301099/v1_201906191703/en/main.pdf?idApp=UINPBA000046&text.app=https://www.revistagastroenterologiamexico.org/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2255534X18301099?idApp=UINPBA000046"
]
Share