Journal Information
Visits
...
Original article
DOI: 10.1016/j.rgmxen.2021.07.001
Open Access
Available online 25 July 2021
Association of Fusobacterium nucleatum infection and colorectal cancer: A Mexican study
Asociación entre infección por Fusobacterium nucleatum y cáncer colorrectal: un estudio mexicano
Visits
...
H. Cuellar-Gómeza, M.E. Ocharán-Hernándeza,
Corresponding author
estherocharan@gmail.com

Corresponding author.
, C.C. Calzada-Mendozaa, D.A. Comoto-Santacruzb
a Sección de Estudios de Posgrado e Investigación, Escuela Superior de Medicina Instituto Politécnico Nacional, Mexico City, CDMX, Mexico
b Escuela Militar de Graduados de Sanidad, Mexico City, CDMX, Mexico
Received 29 September 2020. Accepted 09 December 2020
Article information
Abstract
Full Text
Bibliography
Download PDF
Statistics
Figures (3)
Show moreShow less
Tables (3)
Table 1. Clinical data.
Table 2. The fold change (2-ΔΔCt) of F. nucleatum and cytokines in tumor and peritumor tissue samples, compared with normal tissue.
Table 3. Correlation analysis between the fold change of the cytokines in the normal samples and the fold change of F. nucleatum in the tumor and peritumor samples.
Show moreShow less
Abstract
Introduction and aims

Colorectal cancer (CRC) is the third most prevalent cancer worldwide. Many risk factors are involved, and current evidence links the gut microbiota and colorectal carcinogenesis. Fusobacterium nucleatum (F. nucleatum) is proposed as one of the risk factors at the onset and during the progression of CRC, due to immune system and inflammatory modulation.

Materials and methods

Ninety samples from three different regions of the colon were collected through colonoscopy in patients with CRC, and qPCR TagMan® was conducted to detect F. nucleatum and cytokines (IL-17, IL-23, and IL-10) in tumor, peritumor, and normal samples. The differences between them were analyzed and correlated.

Results

The abundance of F. nucleatum determined through the 2-ΔΔCt method in CRC (7.750 [5.790-10.469]) was significantly higher than in the normal control (0.409 [0.251-0.817]) (p < 0.05). There was no significant association between F. nucleatum and the cytokines (p > 0.05).

Conclusions

CRC is a heterogeneous disease that presents and progresses in a complex microenvironment, partially due to gut microbiome imbalance. F. nucleatum was enriched in CRC tissue, but whether that is a cause of the pathology or a consequence, has not yet been clearly defined.

Keywords:
Colorectal cancer
Fusobacterium nucleatum
Inflammation
Cytokines
Microbiota
Resumen
Introducción y objetivos

El cáncer colorrectal (CCR) es el tercer cáncer más prevalente en el mundo. Son muchos los factores de riesgo y la evidencia actual apunta a una conexión entre la microbiota intestinal y la carcinogénesis colorrectal. Se propone al Fusobacterium nucleatum (F. nucleatum) como uno de los factores de riesgo en el inicio y la progresión del CCR, por modulación inmune e inflamatoria.

Materiales y métodos

Se recolectaron 90 muestras de tres diferentes regiones del colon por medio de colonoscopía en pacientes con CCR y se realizó qPCR TagMan® para detectar F. nucleatum y citocinas (IL-17, IL-23 e IL-10) en el tumor, a nivel peritumoral y en tejido normal. Las diferencias entre las muestras fueron analizadas y correlacionadas.

Resultados

La abundancia de F. nucleatum determinada por medio del método 2-ΔΔCt en CRC [7.750 (5.790 - 10.469)] fue significativamente mayor que el control normal [0.409 (0.251 - 0.817)] (P < 0.05). No se observó asociación significativa entre F. nucleatum y las citocinas (p > 0.05).

Conclusiones

El CCR es una enfermedad heterogénea que se presenta y progresa en un microambiente complejo, parcialmente debido a desequilibrio en la microbiota intestinal. La F. nucleatum se encuentra de manera abundante en los tejidos del CCR, pero no está aun claramente definido si esto es casual o consecuencia del CCR.

Palabras clave:
Cáncer colorrectal
Fusobacterium nucleatum
Inflamación
Citocinas
Microbiota
Full Text
Introduction and aims

Colorectal cancer (CRC) is one of the most common malignant tumors of the digestive tract, and is currently deemed a major public health concern.1 Overall, colorectal cancer ranks fourth in incidence (9.2% of the total cancer cases), but second in terms of mortality (9.2% of the total cancer deaths).2 In Mexico, there has been an upward trend in mortality rates from the disease over the past three decades. CRC is ranked among the 10 most prevalent causes of morbidity from malignancies in Mexico.3 Colorectal carcinogenesis is a heterogeneous process associated with various sets of somatic molecular alterations that are influenced by diet, environment, and microbial exposures. Inflammation has been identified as an important risk factor.4 The human digestive tract has over 1014 bacteria, eukaryotes, and viruses that form the so-called gut microbiota. Those microorganisms play a significant role in normal human physiologic activities, including digestion, metabolism, epithelial homeostasis, and gut lymphoid tissue development. Dysbiosis in the gut microbiota, such as changes in its population or composition, can cause specific diseases (e.g., cardiometabolic disorders, inflammatory bowel disease, neuropsychiatric diseases, and cancer).5 Metagenomic analyses involving whole-genome sequencing, transcriptome sequencing, and 16S ribosomal RNA gene DNA sequencing have recently demonstrated F. nucleatum enrichment in CRC tissue, compared with control groups. 6–8 Moreover, F. nucleatum had a close relationship with the poor prognosis of CRC patients and most likely promoted chemoresistance.9,10

F. nucleatum is an anaerobic, gram-negative bacillus, present in species-specific reservoirs in the human mouth, gastrointestinal tract, and other parts of the body. It is now well-established that chronic inflammation induced by bacterial infection increases the risk of cancer.11 A recent study has provided insights into the relation between the gut microbiome and inflammatory cytokine production capacity.12F. nucleatum induces local inflammatory cytokines, including IL-6, IL-8, IL-17, TNF-α, and COX-2, in the tumor microenvironment, and those cytokines can promote tumorigenesis in CRC. 6,13–15 The aim of our study was to evaluate the presence of F. nucleatum and its relation to local inflammation in tumor and non-tumor tissue from Mexican CRC patients.

Materials and methods

A total of 30 consecutive patients (18 men and 12 women, age range: 45-84 years) that presented with CRC, histologically confirmed as adenocarcinoma, underwent colonoscopy at the Department of Colorectal Surgery of the Hospital Militar in Mexico, within the time frame of March-September 2019. Patients with colorectal tumors other than adenocarcinoma, those that received chemotherapy or radiotherapy before colonoscopy, and patients that had comorbid malignancies from other organs were not included. Fresh tumor (a macroscopic lesion) tissue samples, peritumor (close to a macroscopic lesion) tissue samples, and control mucosa samples (10 cm beyond the cancer margins) were collected from each subject. The tissue and control mucosa samples were snap frozen in liquid nitrogen for long-term storage at −80 °C, until use. All patients were enrolled in the qPCR study.

DNA extraction

DNA extraction from the colorectal tissue samples was performed using the TRIzol reagent (Ambion, Carlsbad, CA, USA) and the manufacturer’s corresponding protocol. Complementary DNA (cDNA) synthesis was carried out using the miScript II RT kit® (Qiagen, Hilden, Germany), with the Veriti Thermal Cycler (Applied Biosystems), following the manufacturer’s instructions.

Quantitative real-time polymerase chain reaction

Once cDNA was obtained, the tests were equalized in each sample through dilutions, to form groups and carry out the amplification and sequencing of the bacterial gene, 16S rRNA.16 The V3 and V6 hypervariable regions of the 16S rRNA gene were amplified by PCR from microbial genomic DNA with the forward (TATGGTAATTGTGTGCCAGCMGCCGCGGTAA) and reverse (GGACTACHVGGGTWTCTAAT) primers. The primers were designed with protruding adapters (forward: AATGATACGGCGACCACCGAG), (reverse: CAAGCAGAAGACGGCATACGAGAT), according to the MiSeq™ System, Illumina, Inc. (San Diego, CA, USA), to recognize the Illumina index sequencing adapters that were added in a subsequent PCR. The PCR products were evaluated by 2% agarose gel electrophoresis and then purified. After purification, the PCR products were quantified through spectrophotometry. The samples were normalized to a final concentration of 2 nM. The 16S rRNA libraries were prepared, using a two-step PCR protocol: First, the extracted DNA concentrations were quantified and then all DNA samples were diluted to the concentration of the most diluted DNA sample, and 2 μl of each DNA sample were used for a PCR reaction at 98 °C for 30 s (98 °C for 30 s, 52 °C for 30 s, 72 °C for 30 s) for 20 cycles, and a 4 °C hold. For each DNA sample, four PCR reactions of 25 μl were performed, which were then pooled and cleaned with AmpureXP microspheres. The second PCR reaction, 4 μl from the previous PCR product, were used with the PE-PCR-III-F and PE-PCR-IV-barcode primers in four reactions of 25 μl, with a 98 °C PCR cycle for 30 s (98 °C for 30 s, 83 °C for 30 s 72 °C for 30 s) for 7 cycles, and a 4 °C hold. Each set of four PCR reactions was pooled and the reactions were cleaned up, using 16S metagenomic sequence purification beads. The library concentrations were quantified. The library was sequenced on a single set of Illumina MiSeq lines, for the base pair readings of 300 pairs.

F. nucleatum and cytokine levels were given as relative quantification and determined by 2-ΔCt, where ΔCt was the difference in the Ct number for the test and reference (Glyceraldehyde-3-phosphate dehydrogenase[GAPDH]) gene assay. The fold increase of F. nucleatum and cytokine quantification in the diseased tissue over the matched normal colorectal tissue was calculated as 2-ΔΔCt. Previously published primers and probes17–19 were synthesized by the Integrated DNA Technologies Company (Coralville, Iowa, USA), with the following sequences:

  • 1)

    F. nucleatum: forward primer, 5′ CGC AGA AGG TGA AAG TCC TGT AT 3′. reverse primer, 5′ TGG TCC TCA CTG ATT CAC ACA GA 3′.

  • 2)

    IL-17: forward primer, 5′- CTC ATT GGT GTC ACT GCT ACT G - 3′. reverse primer, 5′ - CCT GGA TTT CGT GGG ATT GTG - 3′.

  • 3)

    IL-23: forward primer, 5′- ACA CAT GGA TCT AAG AGA AGA GG - 3′. reverse primer, 5′- CTA TCA GGG AGC AGA GAA GG - 3′.

  • 4)

    IL-10: forward primer, 5′- AAT AAG GTT TCT CAA GGG GCT - 3′. reverse primer, 5′- AGA ACC AAG ACC CAG ACA TCA A - 3′

  • 5)

    GAPDH: forward primer 5′- GTCTCCTCTGACTTCAACAGCG -3′. reverse primer 5′- ACCACCCTGTTGCTGTAGCCAA – 3′

Statistical analysis

All statistical analyses were performed using the SPSS 25.0 for Windows (SPSS Inc. Chicago, IL, USA). The relation of F. nucleatum to cytokine levels between tumor tissue, peritumor tissue, and matched normal colorectal tissue was given as fold increase 2−ΔΔCt, where ΔΔCt was the median of the difference between ΔCt Diseased Tissue and ΔCt Normal Tissue. Continuous data were expressed as medians (25ᵀᴴ percentile, 75ᵀᴴ percentile). A test of normality was carried out using the Shapiro-Wilk test. Due to the non-Gaussian nature of the qPCR data distribution, non-parametric testing was deemed appropriate. Consequently, the Wilcoxon rank sum test was used to compare the median F. nucleatum levels and cytokines in the diseased tissue versus the matched normal tissue and to compare the F. nucleatum levels between the colon subsites. The Spearman rank correlation coefficient test was performed to compare F. nucleatum quantification with cytokine expression. For all analyses, a p value < 0.05 (two tails) was considered statistically significant.

Ethical considerations

The authors declare that informed consent was obtained from all participating subjects, in accordance with the Declaration of Helsinki, and all samples were coded to protect patient anonymity. The study was approved by the Research Ethics Committee of the Hospital Central Militar, affiliated with the Universidad del Ejército and the Fuerza Aérea de México.

Results

F. nucleatum was more abundant in CRC tumor tissue versus normal tissue.

Through qPCR, we were able to confirm that the fold change of F. nucleatum was significantly higher in the diseased tissue (tumor and peritumor samples), regardless of tumor stage and location, compared with the matched normal tissue, in a Mexican cancer cohort (Fig. 1). The details of the clinical data and cancer stage and location are summarized in Table 1. F. nucleatum and cytokine levels were quantified in the 30 CRC samples and in the respective peritumor and normal samples. A significant increase of F. nucleatum for bacterial DNA was found in the tumor samples (7.750 [5.792-10.469]). A paired analysis of F. nucleatum quantification for the tumor group was performed, using normal tissue (0.409 [0.251-0.817]) (Table 2). Different expressions of F. nucleatum levels were shown along the colon, the highest of which was in the proximal colon, with a median fold change of 11.294 and 10.985 in the tumor and peritumor samples, respectively. However, no significant differences between locations were found (p > 0.05) (Fig. 2). Interleukin 23 (IL-23) (0.272 [0.125-0.345]) was significantly reduced in the tumor tissue, compared with the normal samples (1.261 [0.509-1.750]) (Fig. 3). No significant expression of other cytokine levels was found in our study. Table 2 summarizes the tumor and peritumor fold changes for F. nucleatum and the cytokines, compared with the normal samples. The bacterial levels were not significantly correlated with the cytokine levels in the tumor tissue or the peritumor tissue (Table 3).

Figure 1.

The fold change of Fusobacterium nucleatum in the peritumor samples and the tumor samples, compared with the normal tissue, according to the Wilcoxon sum rank test, was: F. nucleatum in the tumor tissue: *p = 0.020. FN: Fusobacterium nucleatum.

(0.05MB).
Table 1.

Clinical data.

Clinical diagnosis overview  Mexican cohort 
Total number of tissue samples  90 
Sex, n (male/female)  18/12 
Age, mean ± SD (years)  65 ± 10 
Location, n (proximal colon/ distal colon/ rectum)  7/11/12 
Body mass index, mean ± SD (kg/m²)  32.5 ± 3.0 
Indication for colonoscopy, n (bleeding/abdominal pain/ change in bowel habits/ weight loss)  12/4/9/5 
CEA, mean ± SD (ng/mL)  25 ± 32 
Stage, n (stage I, stage II, stage III, stage IV)  3/10/11/6 

CEA: carcinoembryonic antigen; SD: standard deviation.

Table 2.

The fold change (2-ΔΔCt) of F. nucleatum and cytokines in tumor and peritumor tissue samples, compared with normal tissue.

  IL-17  IL-10  IL-23  F. nucleatum 
Tumor/normal         
FC median  1.741  6.536  0.272  7.750 
FC range  0.632 - 2.875  1.383 - 13.336  0.125 - 0.345  5.792 - 10.469 
p value  0.564  0.248  0.021*  0.020* 
Peritumor/normal         
FC median  0.770  3.639  0.876  4.087 
FC range  0.403 - 0.868  0.032 - 22.935  0.064 - 2.796  1.062 - 9.725 
p value  0.564  1.000  0.564  0.081 
Tumor/Peritumor         
FC median  0.817  3.978  1.030  0.318 
FC range  0.244 - 3.717  0.009 - 6.495  0.291 - 12.692  0.212 - 1.226 
p value  0.309  0.564  0.773  0.248 

FC: fold change; IL: interleukin.

Wilcoxon sum rank test.

*

p value < 0.05 was considered statistically significant.

Figure 2.

The fold change of cytokines in the peritumor samples and the tumor samples, compared with the normal tissue, according to the Wilcoxon sum rank test, was: IL-23 in the tumor tissue: *p = 0.021. IL: interleukin.

(0.07MB).
Figure 3.

The fold change of Fusobacterium nucleatum in the colon subsites. FN: Fusobacterium nucleatum.

(0.08MB).
Table 3.

Correlation analysis between the fold change of the cytokines in the normal samples and the fold change of F. nucleatum in the tumor and peritumor samples.

Spearman correlation coefficient (r)  Tumor  Peritumor 
IL-17  0.80  -0.20 
p value  0.80  0.20 
IL- 23  -0.80  0.20 
p value  0.20  0.80 
IL-10  0.80  0.80 
p value  0.20  0.20 

IL: interleukin.

Spearman correlation test.

*p value < 0.05 was considered statistically significant.

Discussion

Alterations in the gut microbial composition are thought to play a role in colorectal cancer development.4,5,20 The results of the present study confirm, for the first time in Mexican patients, previous reports from North America, Europe, and Asia6,7,10,21 that F. nucleatum is over-represented in tumor tissue, compared with normal tissue in CRC. Even though there were no significant differences between F. nucleatum levels and tumor location, a high level of the bacterium was observed in the proximal colon. There are well-known differences in clinical, pathologic, and epidemiologic features between proximal and distal colon cancers.22,23 The same differences are seen between the microbiota in the proximal and distal colon. Flynn et al. found that differences in the microbiota of the proximal and distal colon in healthy individuals could be due to the differences in oxygen distribution along the colonic mucosa. The proximal colon primarily hosts aerobic bacteria in its mucosa, and adversely, the distal colon mainly harbors anaerobic species.24 Today, there is growing evidence that various risk factors related to CRC development (smoking, inflammatory bowel disease, high alcohol consumption, excessive consumption of red meat, diabetes mellitus, obesity, and genetic predisposition) greatly affect the synthesis of the gut microbiota.25 Consequently, some bacterial populations are minimized, whereas other bacteria that are rare colonizers of the colon, such as Fusobacterium and Lactococcus, display adaptive behavior to the new environment, thus confirming the hypothesis of a “bacterial driver-passenger” model that plays a key role in CRC pathogenesis.26 Moreover, some studies on bacterial biofilms of the colonic mucosa have provided novel insight into the different pathogenetic mechanisms underlying CRC tumorigenesis between the colonic regions.27 Cancers located in the right colonic regions (cecum, ascending colon, and hepatic flexure) generally demonstrate the substantial presence of biofilms.28 Dejea et al. showed that biofilms were associated with human colon cancer and linked to cancer location, with biofilm positivity in virtually all adenomas and cancers located in the right colonic regions, whereas cancers located in the left colonic regions (distal colon to hepatic flexure) rarely possessed biofilms.28,29 Those bacterial biofilms were related to epithelial changes that characterize the progression of tumorigenesis, including diminished E-cadherin and increased levels of the angiogenic and proinflammatory cytokines.30 Using the “bacterial driver-passenger” model, F. nucleatum has been shown to cause an inflammatory microenvironment that is more favorable for CRC development, in contrast to other bacteria that colonize at the tumor site.6 A persuasive interpretation of the aforementioned data is an important issue. First of all, is F. nucleatum a cause of CRC or a consequence of the disease? So far, increasing evidence is in favor of the “cause” hypothesis, as emerging data have demonstrated that F. nucleatum initially induced precancerous lesions (e.g., hyperplastic polyps and adenomas) that eventually progressed to CRC.9,31 In addition, several pathogenetic studies have supported the carcinogenic role of F. nucleatum, which promotes an oncogenic and inflammatory response via FadA, the major virulence factor of F. nucleatum, binding to E-cadherin and activating the B-catenin pathway.32 Moreover, the presence of F. nucleatum in the gut affects tumor-related cytokines involved in CRC tumor progression.15,33 In the tumor samples, we found that IL-23 was significantly decreased, compared with the normal tissues, whereas there were increases in IL-17 and IL-10, but the difference with normal tissue was not significant (Fig. 1). Because of our study’s cross-sectional nature, the increase in IL-17 lends support to the majority of studies that consider said interleukin an important promoter in tumor initiation and CRC progression, through the IL-23/IL-17 pathway, which has a critical role in CRC pathogenesis.34–36 In our study, there was a decrease in IL-23, leading us to suppose that its reduction during tumor development was due to the fact that it functions as a starter of the IL-23/IL-17 pathway, resulting in an increase in IL-17. Grivennikov et al. demonstrated that interleukin 23 signaling promoted tumor growth and progression, and the development of a tumoral IL-17 response. IL-23 is mainly produced by tumor-associated myeloid cells that are likely to be activated by microbial products.37 Recently, Kostic et al. reported that F. nucleatum selectively expanded myeloid-derived immune cells in colorectal cancer. During tumor progression, reactive myeloid cells could possibly mediate immunosuppression by interleukin 10 (IL-10) production.6 IL-10 is known to be a potent anti-inflammatory cytokine.38 Due to its immunosuppressive effect on dendritic cells and macrophages, IL-10 can dampen antigen presentation, as well as cell maturation and differentiation, allowing tumor cells to evade the immune surveillance mechanism.39 Some studies have shown that miR-21 produced by F. nucleatum increased the levels of IL-10 and prostaglandin E2 (PGE2) in colorectal cancer cells,40 and McCoy et al. found a significant positive correlation between F. nucleatum abundance and IL-10 expression in rectal mucosa biopsies from adenoma patients, compared with normal controls.31 Our results suggest an expansion of F. nucleatum colonization in CRC tissues, a phenomenon that could lead to increased proinflammatory mediators (cytokines), such as IL-10. A study by Proença et al. examined the influence of F. nucleatum in colorectal adenoma and CRC on inflammatory mediator expression through miRNA activation that contributed to colorectal carcinogenesis.41 If validated, F. nucleatum DNA in colorectal carcinoma tissue could be a prognostic biomarker. In addition, our study might provide insights for future studies to develop strategies for colorectal cancer prevention and treatment, through targeting the microbiota.

The present study has several notable strengths and limitations. Its strengths include the use of DNA extracted from frozen fresh tissue, with no tissue fixation, resulting in > 99% successful qPCR assays (based on consistent amplification of the human GAPDH reference gene in all tumor samples, peritumor samples, and matched normal samples), and the fact that we assessed the prognostic utility of F. nucleatum DNA measurement in CRC patients, reflecting the main features in Mexican patients. An important limitation was the low number of patients included in the study (n = 30). Testing should be carried out on a larger sample, and more intestinal bacterial species, in addition to F. nucleatum and cytokines, should be analyzed, as well.

Conclusion

The present study supports the evidence that the presence of F. nucleatum, as a symbiotic bacterium in the human intestinal tract, is related to the development of CRC. F. nucleatum is apparently stimulated in the proximal colon to promote CRC through different virulence mechanisms, such as adhesion to the intestinal epithelium and induction of inflammatory and immune responses in the host. Among those responses are cytokine synthesis and release, including activation of the IL-23/IL-17 signaling pathway, which leads to CRC progression. Therefore, F. nucleatum plays an important role in colorectal carcinogenesis and could be targeted for colorectal cancer prevention and treatment in the future.

Financial disclosure

The authors declare that no funding was received in relation to this research project.

Author contributions

H. Cuellar-Gomez designed and performed the research and drafted the manuscript, M.E. Ocharan-Hernandez designed the research and contributed to the analysis, and C. C. Calzada-Mendoza and D.A. Comoto-Santacruz supervised the research and contributed to the analysis.

Conflict of interest

The authors declare that they have no conflicts of interest.

Acknowledgements

H Cuellar-Gomez gratefully acknowledges the scholarship from the CONACyT to pursue his postgraduate studies.

References
[1]
S.Y. Tam, V.W.C. Wu.
A review on the special radiotherapy techniques of colorectal cancer.
Front Oncol, 9 (2019), pp. 208
[2]
F. Bray, J. Ferlay, I. Soerjomataram, et al.
Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries.
CA Cancer J Clin, 68 (2018), pp. 394-424
[3]
J.J. Sánchez-Barriga.
Mortality trends and risk of dying from colorectal cancer in the seven socioeconomic regions of Mexico, 2000–2012.
Rev Gastroenterol Mex, 82 (2017), pp. 217-225
[4]
J.C. Clemente, L.K. Ursell, L.W. Parfrey, et al.
The impact of the gut microbiota on human health: an integrative view.
Cell, 148 (2012), pp. 1258-1270
[5]
D. Rea, G. Coppola, G. Palma, et al.
Microbiota effects on cancer: from risks to therapies.
Oncotarget, 9 (2018), pp. 17915-17927
[6]
A.D. Kostic, E. Chun, L. Robertson, et al.
Fusobacterium nucleatum potentiates intestinal tumorigenesis and modulates the tumor-immune microenvironment.
Cell Host Microbe, 14 (2013), pp. 207-215
[7]
M. Castellarin, R.L. Warren, J.D. Freeman, et al.
Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma.
Genome Res, 22 (2012), pp. 299-306
[8]
M.H. Fukugaiti, A. Ignacio, M.R. Fernandes, et al.
High occurrence of Fusobacterium nucleatum and Clostridium difficile in the intestinal microbiota of colorectal carcinoma patients.
Braz J Microbiol, 46 (2015), pp. 1135-1140
[9]
K. Mima, R. Nishihara, Zr Qian, et al.
Fusobacterium nucleatum in colorectal carcinoma tissue and patient prognosis.
[10]
T. Yu, F. Guo, Y. Yu, et al.
Fusobacterium nucleatum promotes chemoresistance to colorectal cancer by modulating autophagy.
[11]
C. de Martel, S. Franceschi.
Infections and cancer: established associations and new hypotheses.
Crit Rev Oncol Hematol, 70 (2009), pp. 183-194
[12]
M. Schirmer, S.P. Smeekens, H. Vlamakis, et al.
Linking the Human Gut Microbiome to Inflammatory Cytokine Production Capacity.
Cell, 167 (2016), pp. 1125-1136
[13]
H. Liu, X.L. Hong, T.T. Sun, et al.
Fusobacterium nucleatum exacerbates colitis by damaging epithelial barrier and inducing aberrant inflammation.
J Dig Dis, 21 (2020), pp. 385-398
[14]
S. Zhang, S. Cai, Y. Ma.
Association between Fusobacterium nucleatum and colorectal cancer: Progress and future directions.
J Cancer, 9 (2018), pp. 1652-1659
[15]
X. Ye, R. Wang, R. Bhattacharya, et al.
Fusobacterium nucleatum subspecies Animalis influences proinflammatory cytokine expression and monocyte activation in human colorectal tumors.
Cancer Prev Res (Phila), 10 (2017), pp. 398-409
[16]
D.W. Fadrosh, B. Ma, P. Gajer, et al.
An improved dual-indexing approach for multiplexed 16S rRNA gene sequencing on the Illumina MiSeq platform.
Microbiome., 2 (2014), pp. 6
[17]
N. Topcuoglu, C. Paltura, M. Külekçi, et al.
Real-Time polymerase chain reaction versus conventional PCR: a comparison between two methods for the detection of Fusobacterium nucleatum in saliva, nasopharyngeal secretion and middle ear effusion samples.
Biotechnol Biotechnol Equip, 27 (2013), pp. 3825
[18]
N. Suzuki, A. Yoshida, Y. Nakano.
Quantitative analysis of multi-species oral biofilms by TaqMan Real-Time PCR.
Clin Med Res, 3 (2005), pp. 176-185
[19]
R.D. Barber, D.W. Harmer, R.A. Coleman, et al.
GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues.
Physiol Genomics, 21 (2005), pp. 389-395
[20]
J. Chen, J.C. Domingue, C.L. Sears.
Microbiota dysbiosis in select human cancers: Evidence of association and causality.
Semin Immunol., 32 (2017), pp. 25-34
[21]
J. Repass.
Replication Study: Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma.
[22]
B. Iacopetta.
Are there two sides to colorectal cancer?.
Int J Cancer., 101 (2002), pp. 403-408
[23]
P. Gervaz, P. Bucher, P. Morel.
Two colons-two cancers: paradigm shift and clinical implications.
J Surg Oncol, 88 (2004), pp. 261-266
[24]
K.J. Flynn, M.Tt Ruffin, D.K. Turgeon, et al.
Spatial variation of the native colon microbiota in healthy adults.
Cancer Prev Res (Phila), 11 (2018), pp. 393-402
[25]
G.D. Wu, J. Chen, C. Hoffmann, et al.
Linking long-term dietary patterns with gut microbial enterotypes.
Science, 334 (2011), pp. 105-108
[26]
H. Tjalsma, A. Boleij, J.R. Marchesi, et al.
A bacterial driver-passenger model for colorectal cancer: beyond the usual suspects.
Nat Rev Microbiol, 10 (2012), pp. 575-582
[27]
H.M. Probert, G.R. Gibson.
Bacterial biofilms in the human gastrointestinal tract.
Curr Issues Intest Microbiol, 3 (2002), pp. 23-27
[28]
C.M. Dejea, E.C. Wick, E.M. Hechenbleikner, et al.
Microbiota organization is a distinct feature of proximal colorectal cancers.
Proc Natl Acad Sci U S A, 111 (2014), pp. 18321-18326
[29]
S. Li, S.R. Konstantinov, R. Smits, et al.
Bacterial biofilms in colorectal cancer initiation and progression.
Trends Mol Med, 23 (2017), pp. 18-30
[30]
C.M. Dejea, C.L. Sears.
Do biofilms confer a pro-carcinogenic state?.
Gut Microbes, 7 (2016), pp. 54-57
[31]
A.N. McCoy, F. Araujo-Perez, A. Azcarate-Peril, et al.
Fusobacterium is associated with colorectal adenomas.
[32]
M.R. Rubinstein, X. Wang, W. Liu, et al.
Fusobacterium nucleatum promotes colorectal carcinogenesis by modulating E-cadherin/beta-catenin signaling via its FadA adhesin.
Cell Host Microbe, 14 (2013), pp. 195-206
[33]
Y.N. Yu, T.C. Yu, H.J. Zhao, et al.
Berberine may rescue Fusobacterium nucleatum-induced colorectal tumorigenesis by modulating the tumor microenvironment.
Oncotarget., 6 (2015), pp. 32013-32026
[34]
Y.S. Hyun, D.S. Han, A.R. Lee, et al.
Role of IL-17A in the development of colitis-associated cancer.
Carcinogenesis, 33 (2012), pp. 931-936
[35]
D.S. Straus.
TNFa and IL-17 cooperatively stimulate glucose metabolism and growth factor production in human colorectal cancer cells.
Mol Cancer, 12 (2013), pp. 78
[36]
S. Razi, B. Baradaran Noveiry, M. Keshavarz-Fathi, et al.
IL-17 and colorectal cancer: From carcinogenesis to treatment.
Cytokine, 116 (2019), pp. 7-12
[37]
S.I. Grivennikov, K. Wang, D. Mucida, et al.
Adenoma-linked barrier defects and microbial products drive IL-23/IL-17-mediated tumour growth.
Nature, 491 (2012), pp. 254-258
[38]
R. Sabat, G. Grutz, K. Warszawska, et al.
Biology of interleukin-10.
Cytokine Growth Factor Rev, 21 (2010), pp. 331-344
[39]
Hamidullah, B. Changkija, R. Konwar.
Role of interleukin-10 in breast cancer.
Breast Cancer Res Treat, 133 (2012), pp. 11-21
[40]
K. Nosho, Y. Sukawa, Y. Adachi, et al.
Association of Fusobacterium nucleatum with immunity and molecular alterations in colorectal cancer.
World J Gastroenterol, 22 (2016), pp. 557-566
[41]
M.A. Proenca, J.M. Biselli, M. Succi, et al.
Relationship between Fusobacterium nucleatum, inflammatory mediators and microRNAs in colorectal carcinogenesis.
World J Gastroenterol, 24 (2018), pp. 5351-5365

Please cite this article as: Cuellar-Gómez H, Ocharán-Hernández ME, Calzada-Mendoza CC, Comoto-Santacruz DA. Asociación entre infección por Fusobacterium nucleatum y cáncer colorrectal: un estudio mexicano. Rev Gastroenterol México. 2021. https://doi.org/10.1016/j.rgmx.2020.12.002

Copyright © 2021. Asociación Mexicana de Gastroenterología
Idiomas
Revista de Gastroenterología de México

Subscribe to our newsletter

Article options
Tools
es en
Política de cookies Cookies policy
Utilizamos cookies propias y de terceros para mejorar nuestros servicios y mostrarle publicidad relacionada con sus preferencias mediante el análisis de sus hábitos de navegación. Si continua navegando, consideramos que acepta su uso. Puede cambiar la configuración u obtener más información aquí. To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here.